Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ215222
Length 435 bp
Fasta Format > rwh6a22
gcaaaacatatgctccatagcccatacagttatacccagnaataccaata tgatactaatacattgttcgagtgggaagttctggcacaacactgaacaa aacagggatatcatcagcttagaagagagaggtccccttgcccttcttgt ctccaccgatctcaaagtgcttgcacctcttgatagcgcgttgcgagtaa tgcttgcagctctggcactgcagcttcagcacaatcttctttgttgtctt ggccttcttgtggaaaacaggctttgtctggccaccatatcctgactgct tgcggtcgtaacggcgctttccctgagcagaaagactgtccttgcctttc ttgtactgcgtaaccttgtggagggtgtgcttcttgcactccttgntctt gcagtaggtcttcttggtctttggaacgttcacca
Download
page-top