Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ516343
Length 711 bp
Fasta Format > rwhfl52b04
ttataagaatccagattagttcagcgaatcataccatgctgctaactgta attcagcatgcagaaattcctcaaagtttgaatgttctcaatacatcagt aatcatatgtgaaaatctgcaagtccctctttaagacaacaatgcgagtg tgtaaaaatgcagacgctaagacatcacagcctcatatcctactggagct tcttctttgacgcttctcaggcattcatctgcttttctttgtcgagtaaa tacggggagctaacacgtgctgttatagttcatcgtcgaccggggccgta gcacttgtggactgacagtgtttgctaatatcctggcaaagggcctggct cacgtccgcggattctgccgagcttgtttttatccactcagcaagctcgt cctcagtttcctccagtaaccttccacagtaactggatagatttttggag tgtgctcgtgctgcagctttcttatcagtttgaaaactgctccagcttgg tactttcacccattctttttcgcctgattccaacttctgcagcgtatagt cttgcatcttatcacataggtcatccagaagctctacaatccgaagctcg ctgactctgtaatcgatgaccttcccctcgcgctgacctttcgaatttaa cctgttacgcaagtccaagtgatttcttggtttctcacttgatattccaa tctctagctca
Download
page-top