Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ516253
Length 584 bp
Fasta Format > rwhfl51l08
gaagctagttccttttcacaacaaaccagctcgtctaatccgttcagaaa ctgatgtctctagaatacaagttttccagtttcatnaaaacgtgtaatat tctcccaaaaaaaagtggaagtatttctaccacacaaactgtgcttattt ctgccgaagaatcctgaatgcttaatcttgcctataaatgaagaatttat aggagaaacaaggtgaagggtgcgagtgcgaatcagggtaatctctgtat caggctgtcagcttaaaccagaggacctcaaagctttggtttggattctc tagaccatgccggagctctaactttcaggttggacttctcagcctcctcg tccttctcctcctcttccaaaatctccttanagaatgccgctggattctc tttgatgcagttctgcagcgcgatgaagggctgcacgcagnctgatccct tctctacttctgagctcctcangaagcaggaaaatgcatcaataaatcca ttgccacaaggtccagttttcaaatcagccacgcacggacaatccagagc tttctgcaccttaacgtcaattgactcatcatcc
Download
page-top