Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ515944
Length 642 bp
Fasta Format > rwhfl50d17
ttactcccagactactccaagcatgtttacatgataagacgtgtcgatca ggaatttatttcaggcggtggtggtaacgagctagtacatcataactaat gttctgagggtccgactgtcagagcctttttatcttgttggatccccctt gaggaggtcttccaccgagcttttgtattttgcgatcaaatcctttcttt gatcaagcagctgacgggtttcttccaaactttgcatttgtccttcaacc gtaacagatttcgagcttagtgttcctgaaatggagttcaataactgctg gctcctggcaaattgactggtcaattcttcaaccaatgcatcaaaagctt gatcccttgtgcctgttgcaatcgcatcacctaatcttgtcaccaagtgg aggaggtggaaatgggacgcgagcgaggggtggtggtgctgcggcggcgg cgtcgcttgctgctgcggctgctggtactgaagggcgtgggcatggtcgg gctgcggggagagcaccagcggccggtagtggtcgccgtgctgctgcggg agcggcggcgggtggtgatggtccatcttcccccttcccacctcctgctg gacggatctgtggcgatttggatcgaggatttgggttgctag
Download
page-top