Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ515375
Length 298 bp
Fasta Format > rwhfl48i02
atatatcataacttccagacacagcggctaacattccattcacacaaaca aaagcatcatcaactccaaactccatccatgccagggaatgaaaacgctc catctaactaaaagcacccattattatcaatacaaaccaaacccattgtc ccgggcaggttgagaggcngcagcagctagtttcaaagttaagggcgcat ttgtttatgatgatcccggggtggaggcgcttgcggcggctgcgaaggtt gcctcctccttcttcttcaggtcctcaaacttgtcgatagtgacctgc
Download
page-top