Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ509240
Length 771 bp
Fasta Format > rwhfl24e09
agacgttacaaaatgtttgcgttccagatacagacagtgtagacacaggc catgacagagcaatctccaaccgtccagccaaacgatgcaacaaagcaag ttgctgtttcaggtggtaacgacagagttcagtcattttagttacaaaca ttttggtacagaaaccgcatgataacacatggtgagctcaacttattagt ctgccgtccagctctgctcaacaatctcccgcactttgcggttgtactct cgcttgttctcactgaacatgcgggcagcttctgagttagcaggcgaatt tgggttaggatcacacagcagcgactggatagatgtaagtatagcagcta catcatatattgggctccactgattctgtagaatatctaagcatatgctt ccatcagcataaatgttagggtgaaacatccgagaaataaaccgaactgt tggtggcttattaggatattcttcattaaactggagagtcagcttaaacg tgcctccatcccacgggctatcgtcagggccaaaaatcacagcattccac agcattatgttgttgtcctgcggcgccccgcttatgccccgcaggagggt cctgcatcagccgcttgaagtccctcatcagcctcttccttgaaggagtc gacatcctcgaaattctctgagatgcggccggcggtgggggtggagacgt gggctccgcgtgctcgttgtcctagagcatggagacgacggaatgggacg gctttaggtcggcctgggcga
Download
page-top