Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ507702
Length 459 bp
Fasta Format > rwhfl18e12
agattattgctgatatatgttcagtagcaaacattatcattattggcttg caagctcaagtcagggggggaggaaaacagtagcagctgctccaccacaa aattactagcatagtacacacataataaacacaggagaaaaaaggagtct cttcatcttcgctgtcttcctccgcaccganagganccacatcaagattt ttcttaggcggacttcacggtggcggcgttgatgatgtcaatgaactcag gcttcnaagaagctccaccaacgaggaaaccatcaacgtcgggctgccct gccaactccttgcagcttgcgccagttacagatcctccatagatgatcct cgtggattcagcaacctcggggctcacattggtcttgagccagtccctca aattggcatggacttcctgcgcctgagccggtgtcgcaactttaccggng ccaatggcc
Download
page-top