Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ506655
Length 426 bp
Fasta Format > rwhfl14a03
ctggattggacgtggaagagaaaaatanaatcagaagcatacaccaactt ggactcggacatggaaaacatacaccaacttggactcggacatggaacca atcgcgaaccatacaccagactcggactggcaaaggttctatactaatat aaatacccagctctcagagattgaacgcccagagaaaaaagtgccaccan cttagtacacgccaagcaatctccaagctacagcgccaaccaaaacaaag gagccgtcaagtatgttccttgtctccagttttcgttcttcccaatgaat tcttgaatctcacacatggtatttgatactcatcagtcctatgtttgatg tccagtaaaaaaataccatgtttcatgcatctcacatgccaggatgctca tccgatacatattgacttcacattcc
Download
page-top