Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ506412
Length 710 bp
Fasta Format > rwhfl13b16
aatctcaaaacataccacaacctactggattggacgtggaagagaaaaat acaatcagaagcatacaccaacttggactcggacatggaaaacatacacc aacttggactcggacatggaaccaatcgcgaaccatacaccaactcggac tggcaaaggttctatactaatataaatacccagctctcagagattgaacg cccagagaaaaaagtgccaccagcttagtacacgccaagcaatctccaag ctacagcgccaaccaaaacaaaggagccgtcaagtatgttccttgtctcc agttttcgttcttcccaatgaattcttgaatctcacacatggtatttgat actcatcagtcctatgtttgatgtccagtaaaaaaataccatgtttcatg catctcacatgccaggatgctcatccgatacatattgacttcacattcca ggccagtctagcaacaaattatcttgtattgcattaaaaaaaaattcttt ccatcctgcttgagatgtatcctcttagaaattactattggatagtaaac ataaactggaacttcaccaagcaattgattttggcacattgaagaaaatg ctcaaaacaaatttggagcggagagcctttgcaatattggaggcgacgtc acagaagcagcggggtcgaggatgggtgtgaagacgagctccccgtcgcc cttctagaag
Download
page-top