Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ505344
Length 466 bp
Fasta Format > whfl8h15
gtccagtgactccctttgcttgcgcctccacagcccccactttccaactt agggttctagggtttctccagcagcgccggcgcctccacccgcccaccca accaccatgacggccgagaccgcgacgcaggcggagctgctacgcgccgt cctggaagagcagaagctcgcggcgcagggagatgagcctgtagttgagg atgatgatgatgaggaagatgaggatgatgatgaccaggatgacaaagac gatgacgtggaaggagttgatgcaagtggaagatctaagcagagtaggag tgagaagaagagcaggaaggccatgctgaagcttggcatgaagactatca ctggcgtcagccgtgtaactgtcaagaagagcaagaatatcctgtttgtc atctccaagccagatgtattcaagagccctgcctctgacacctatgtcat tttcggtgaagctaag
Download
page-top