Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ505273
Length 503 bp
Fasta Format > whfl8c03
tcatcgctgtctggaacagcgatgacttgagaaccgacggaccaccagcc cgtctcgccctgtccgtctctgtctccccgctcccttcgccgccgggtcc aatccagccgcgcccgtggaaacctacctagggtttcgccctcgccgccc tccaaaggtttttggagaagggctgtttgtacagcgacatgaggccaatt ttctgcgggaaccttgaatatgatgcccgccagtctgaaatcgagcgtct tttcggcaaatatggaagagtggagcgagttgacatgaagacaggatttg cgtttgtctacatggaagatgaacgtgatgctgaagatgctatccataga cttgacagaactgactttggtagaaaagcgaggagactgagagtcgaatg gacaaaggaggatcgcagtggtggtcggaaaggaaatgggaagagatctc caagcagcgtgaaaccaaccaaaaccttgtttgtgattaactttgatccg atc
Download
page-top