Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ504944
Length 296 bp
Fasta Format > whfl6k18
atcccaagcttcaacatccacaccactcccttcttctcccagatccatcg acgatgtccgggcgcggcaagggcggcaaggggctgggaaagggcggcgc caagcgccaccggaaggtcctccgcgacaacatccagggtatcaccaagc cggcgatccggaggctggccaggaggggcggcgtgaagcgcatctccggc ctcatctacgaggagacccgtggcgtcctcaagatcttcctcgagaacgt catccgcgacgccgtcacctacaccgagcacgcccgccgcaagacc
Download
page-top