Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ504228
Length 432 bp
Fasta Format > whfl53l02
gcctaccttgtgcgctttactgctccatttactcccgcagagagagaagg gagataatggccgccggcgagagaaacgagtcttcggcggcggcggcggc gccattgctggcagcagcgagggagaggaagctctgcaaggaggggtgcc cagggtgcaggctggacgagatcaacaagagcaagaccggcatcccctac ctcaacttcttctacgtgtgggtcgtctgtctctgcgccgctctaccgat ccagtcactgtttccctatctatacttcatgattagggacttggaagtcg caaagcaagagcaagacattgggttctatgctggttttgttggggctgct tatttccttggaagaaccatcagtgctgtgccatggggcatttttgctga caaatatggggaggaagccttgcattgttatc
Download
page-top