Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ504183
Length 484 bp
Fasta Format > whfl53h11
ctcccacacacctccgcctccaccccacccgtcccgacccctctcctcca aggtaagcccgcggcggcggcgagcgagcgagcggcggcgatgacgaccc gcttcaagaagaaccggaagaagcgcggccacgtgtccgccgggcacggg cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggagg catgcaccaccaccgcatcctcttcgacaagtaccatcccggctacttcg gcaaggtcggtatgcgctacttccacaagctcagcaacaggttctacaca ccgacggtcaacgtcgagaggctctggtccatggttccgtccgacaaggc ggcggaggccggcggcgacaaggcccccgtggtcgacgtctcgcagttcg gctacttcaaggtgctcggcaaggggatgctgccggagaagcccatcgtc gtcaaggccaagctcatctccaagatcgccgaaa
Download
page-top