Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ504129
Length 504 bp
Fasta Format > whfl53d03
actttgccacttcacacacgcatcccctggaagagaggttgggagagata gccatggcgatttggatctccctctcggcgatcgacgcagtttgttgttg gtgactcgcctgcgctctctatcccactcccctgctgcctccgcgccccg ctcgacctcccgtcgccccccgcaccaaccctggccccaatttcccccct ccctccgattttttgttcgtctgattcggtagccctttgaaaaggcacaa gcctaatgttgatgtcatatatgacagaagaccttccatggctagcttca attttgattgcgaatcaaaggatgctcgtcctgttaccaaggcggatcag aatatcggttcagctaatgttgactttgaatttcacccaactagaaacaa cctttcacctattgttccagtgaggctatcccggcattttatagatgagg tcgaccaagttcagtgttcgcaatatgtgtctgaaaggcttcttaactct catg
Download
page-top