Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ503140
Length 171 bp
Fasta Format > whfl49g15
ctctcgcccagtcaaagccagagagcaccagcctcagcctggctggcggg ctgtctcctctgccgctgccgccttcccctccgcctctaaatcctccgcc ccgccccgcctgaccatcgactcgaccggcgccgaatccgggacggcgcg gggtgatgggtgtgtcgccgg
Download
page-top