Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ503018
Length 503 bp
Fasta Format > whfl48n22
atcgtgaggaacgaagcccctccctcccctgtgctctgtcttctatctca cctcccgtgatctctgccgtcccacctcccccgattcatcttcagatcga ggcttccggaggctgcatcgagagtagcaccgccacgcccaactccgctc ccttccggtgctaatccatgctcagcagatctggtcgcgaaaaggacggc gccccaccgcccctgctggatccgccgagccagcggccggatctatcgag atgcgccgggatcccgagccttgttcctccccaccttctcctccgtcgac agtaggcagcagagcaaggcgcgggcgactgctccggccagaggagggcg tgaggtgcgacgcggcctcactggggcgtgactccgtcagccagcaccgg cgcccaactgggatccaccgaacccaggcgcggcctacggcgggcgtgcg gttttgagttcaacaggagagctcgcacgagattgagcgctgctcccgtc ttc
Download
page-top