Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ502936
Length 162 bp
Fasta Format > whfl48h15
tctcctctcgcccagtcaaagccagagagcaccagcctcagcctggctgg cgggctgtctcctctgccgctgccgccttcccctccgcctctaaatcctc cgccccgccccgcctgaccatcgactcgaccggcgccgaatccgggacgg cgcggggtggat
Download
page-top