Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ502684
Length 223 bp
Fasta Format > whfl47d10
atgactactatgcctccggngccgaggacgagtggacgctccaggagaac agggaggcctttgccaggatcctgttccgcccgcgcattctgatcgatgt atccaaaatcgacatgacaacaactatcctgggattcaagctctcaatgc ccatcatgatttcccccactgccatgcagaanatggctcacccagatgga gagtatgcgactgcccgcgcagc
Download
page-top