Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxx_9047_a09f
Length 702 bp
Fasta Format > whxx_9047_a09f
CCTGCTTCCTCCACCAGTCCACCGCGCGCCTGGCCGCCTCGGCGCGCCCT GCGCCCGCCGTCGGGCGCACCCAGCTTTTCGTCTGCAAGGCGCAGAAGAA TGACGAGGCTGCATCTGACGCTGCCGTCGTCACCAGCCGGCGCGCCGCGC TGTCCCTCCTCGCCGGTGCCGCCGCCATCGCCGTCAAGGTCTCCCCCGCC GCCGCCGCCTACGGAGAAGCAGCCAACGTGTTCGGCAAGGCGAAGAAGAA CACGGACTTCGTGGCGTACAGCGGCGAGGGGTTCAAACTGATGATCCCGG CCAAGTGGAACCCCAGCAAGGAGCGTGAGTTCCCTGGGCAGGTGCTCCGC TACGAGGACAACTTCGACGCCACCAGCAACCTCTCCGTTATAATCAACCC CACTACCAAGAAGACCATCACCGACTACGGTTCCCCTGAGGAGTTCCTCT CCCAGGTCGGCTTCCTCCTCGGCCAGCAGTCCTACGGTGGCAAGACCGAC TCCGAGGGTGGGTTCGAGTCAGACGCTGTGGCGACGGCGAACGTGCTGGA GAGCTCGGCGCCGGTGGTGGACGGTAAGCAGTACTACAGCATAACGGTGC TCACGAGGACCGCGGACGGAGACGAGGGAGGGAAGCACCAGCTCATCACC GCCACCGTCGCCGACGGCAAGCTCTACGTCTGCAAGGCGCAAGCCGGAGA CA
Download
page-top