Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxw_3048_a12r
Length 758 bp
Fasta Format > whxw_3048_a12r
CATCATCCAGGTGCTACAGCTTCGATCTGAACCAAACAACAGGATGTTCT TCACATCATCGAGACATTCGTGAGACTGCCCACCACGTACGCACTTTTAT GTTGCCGAAGGCATTATGGACCCGACGACTCTTCCCATGGCTGGCTTAGT AGTCGTTGCCGGCGACGGAGCTGTGGTCGTCGCACATGTACACGTACCGG TAGACGACGCCGGCGAGGCCACCGCCGATGAGCGGGCCGGCCCAGTAGAT CCAGATGTTGGTGAAGTCGCCGCTGGCAACGGCGGGGCCGAAGGAGCGTG CAGGGTTCATGGACCCGCCGGAGAAGGGGCCGGCAACGAGGATGTTGGCG CCGACGATGAAGCCGATGGCGATGGGGGCGATGGTGCCGAGGGAACCCTT CTTGGGGTCGGCGGCGGTGGCGTACACGGTGTAGACGAGCCCGAAGGTGA CGATGATCTCCATCACGACGCCCTCAAAGGCGCCCACGCCGGAAAGCCCG TGTGTAGGGGTCGCCACGCCGGTGCAGAACTGGACGAGGAAGGCGCCGAC GATGGCACCGAGGAGCTGGGCAACCCAATAGAAGATGCCGGTGAGGATGG TGATCTGGCCGCCGAGGGCGAGGCCGAAGGTGACGGCAGGGTTCACGTGG CCGCCGGAGATGTTGGCGCCGATGGCGACCGCGACGAACAGCCCGAAGCC GTGGCATATCGCCACGGCAATCAGCCCGGATGGGTCAAGGGGCGCGCCGC CGCTCACC
Download
page-top