Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxw_3015_a01r
Length 580 bp
Fasta Format > whxw_3015_a01r
TGATATTCGGGTCAGCGTGTATGTAAGACATTTTTGGGAAATTTCATTGA AAGTAGGAAAATGATACTATATAGATCCATGAAGTTACATAACATGATTG GCCCAACCAACTGATTGTGAGATATACTGAACTTGGACACGGACGTTAGC TCCATCATGGAAGATGGAACTAATCCGCTTATAGATCATTCATCTCCTGT TACGACTTTGTTGCTCCCAGACACGACATGGTTGCTTCCAGATACGNTAT TGTTGCTCCCAGATACTGTATTGCGGCTCCCGGATACCGTATGGAAGCTC CCGGATACATTATTGTCGTTTCCGGATACGGCATTGTTGTTGTCAGTTAT GACATGCTTGTTCCCAGATACGACATGGTTGCTTCCAACTACGGTATTGT CACTCCCGGTTANNNTAGTGTTGTTACTCCCTGACACACTGTTGTTGTTC CCAGATATGACAGTGTTGTCATTCCCAGAAACAACATTGGTGCTCCCAGA TCTGACGGTATTGTTGGTCCCTGATATCGTATTTGGTTGAGGTTGTTGTT GGAGTGTTCTTCTATTACGCTTCACATACA
Download
page-top