Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX198919
Length 754 bp
Fasta Format > whxu_23052_n15f
CATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAATGGCTCATT AAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAGT AATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGCGCA TTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATTC ATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCATCATTCA AATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGTG GTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGA AACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCC TGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGCATTAGTGT CTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGG AGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA TATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGACCTTGGGCCGGGT CGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCGACCCTTCGGCCGG CATCGCGCTCCTAGCCTTAATTGGCCGGGTCGTGTTTCCGGCATCGTTAC TTTGAAGAAATTAGAGTGCTCAAAGCAAGCCATCGCTCTGGATACATTAG CATG
Download
page-top