Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX196880
Length 765 bp
Fasta Format > whxu_25085_l21r
TGCACGCTCCATTAAACCGCGTGCAATACAAAAGGAAGGGAAAGTACAAC AGGGAGTACTGAAACTCGCAGACTTGAACAGGTGACGCTGCCGACAGGCA CACACACCGAGGAGAGGAGGAACAGCACGGTAGATATAGATGATCACAGC GTGCGCGGCCGAGACATGATCCACGTCCTACGCGCGCGCGAGCAACCACC ACCACCACATGATCGATCGACCGACGATGAACAGCGATAAGATTCCATCC GCATGCAGCTGGTTGATTGGTGGACTAGTCGCGGCTCTTGAAGGGGATGG CCCTGATCACAACCACGTGGTAGATGGCCGCCAGCGCCGCGCCGATGAAC GGACCCACCCAGAAGATCCAGTGGTCGTCCCACGCCTGCTTCTTGTTGTA GATGATGGCGGCGCCCAGGGACCTCGCCGGGTTGATGCCGGTGCCCGTGA TGGGGATCGTGGCCAGGTGCACCAGGAACACCGCGAACCCGATCGGAAGC GGCGCCAAAATGGGGACGTGGGAGTCTCTGGCGCTGCGCTTGGCGTCGGT GGCGGAGAAGACGGTGTACACCAGCACGAACGTCCCAACAATCTCAGCCC CAAGCCCGTCCCCCTTGGTGTACCCCGGCGCGACGGAGTTGGCGCCGCCG CCGTTGCCCTGGTACAGCGTGGTCTGGAACCCCTTGACAACCCCAGCGCC GCATATGGCCCCNNNNNACTGCATCACGATGTAGAACACCGCCCTGGTGA GCGACAGCTTCCTGG
Download
page-top