Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ497637
Length 531 bp
Fasta Format > whfl26p21
ggacggacattttttctccccaaccagcgaggaagaggaagaggaagcgg atcgagtcggcgagagcgagggcgaggacgatggcggcgctccggctagc ggtgaggagattttgcgaccgtgcgctcgggagatcagcgggcatttacg agctcaaggctgccaaggaattccccgacattgatcctgggcatctcaag gctgccaggaaattccccaaacttcgtgtcaaggatgttgatgctacggc tctgaatgtcttcaagattctcaggcagagtccagtcgatggtcatgtgc gcatgacactcaagaccttggctgagattcaggaagaagaatgaagatgc gctactaggaagcaatatcgtctcttgctctaatatgaactagctttgca gtattgtagtatttgaatctttcctatgttgtcgctctgtgtctcgatct tcaaaactgctggacggatgtgatgttttgctattttcttgcttcacaag gttgaatcatcctttgatcttgacatgccca
Download
page-top