Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ497206
Length 528 bp
Fasta Format > whfl25b09
ggacggacattttttctccccaaccagcgaggaagaggaagaggaagcgg atcgagtcggcgagagcgagggcgaggacgatggcggcgctccggctagc ggtgaggagattttgcgaccgtgcgctcgggagatcagcgggcatttacg agctcaaggctgccaaggaattccccgacattgatcctgggcatctcaag gctgccaggaaattccccaaacttcgtgtcaaggatgttgatgctacggc tctgaatgtcttcaagattctcaggcagagtccagncgatggtcatgtgc gcatgacactcaagaccttggctgagattcaggaagaagaatgaagatgc gctactaggaagcaatatcgtctcttgctctaatatgaactagctttgca gtattgtagtatttgaatctttcctatgttgtcgctctgtgtctcgatct tcaaaactgctggacggatgtgatgttttgctattttcttgcttcacaag gntgaatcatcctttgatcttgacatgc
Download
page-top