Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ496126
Length 577 bp
Fasta Format > whfl20f07
ctcgttccttccttcccttcccctcagccttgaggggacagtcagccaca gcctcctcatacaagaaaaatggagatcaccaatgtcacagagtaccagg ccatcgccaagcagaagcttcccaagatgatctatgactactatgcctcc ggtgccgaggacgagtggacgctccaggagaacagggaggcctttgccag gatcctgttccgcccgcgcattctgatcgatgtatccaaaatcgacatga caacaactatcctgggattcaagctctcaatgcccatcatgatttccccc actgccatgcagaagatggctcacccagatggagagtatgcgactgcccg cgcagcatcagcagcaggcactataatgacattgtcgtcctgggctactt caagtgttgaggaggttgcctcaaccggaccagggatccgtttcttccaa ctctatgtctacaaagacaggaaggtggtcgagcagcttgtgaggagagc ggaaaaggctggattcaaggcgatagcgctcaccgtggacaccccgcgac ttggccgcagggaagctgatatcaaga
Download
page-top