Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ496012
Length 516 bp
Fasta Format > whfl1l20
agggactcggcaaaaccctaattttcacccagttcggcccttccaaaccc taaccctaatacgctcgatgttgtaatcccgccgcgtttgccatggctct agaggggcccgcggagcgacgggacgagggccagcagggagggatggcga acgggaatggcgtggctccgccgccgtcgcgcatggccggccggccgttg ggggcggctgcgtactctgacaggcggctgcgcctcaatccgaacacgga gcacaagccgcaggactacaccgacgtgcgcggcgagtacgcgccagccg tgtacagcgccctggagcggcacctcccgcctagcctcctcgaggccgac cgtgatgtcaagctacacttcatgcgggacatactcgcgcgctattggcc ccatggcgagcgaaacaaggttcataggcacaaagaatacaggcagaaga tagtccaccctctataagccacttcatcaagaattgtacagcatgcattc cttcggctttcttctt
Download
page-top