Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ495199
Length 537 bp
Fasta Format > whfl17a10
aagtctagggtttcttcgcataagcagagcggcgatggcgaaggcggagg cggaggcggaagtggactcctaccaccggaggccccccgtcctcagtttc ttctagaagggcgacggggagctcgtcttcacacccatcctcgaccccgc tgcttctgtgacgtcgcctccaatattgcaaaggctctccgctccaaatt tgttttgagcattttcttcaatgtgccaaaatcaattgcttggtgaagtt ccagtttatgtttactatccaatagtaatttctaagaggatacatctcaa gcaggatggaaagaatttttttttaatgcaatacaagataatttgttgct agactggcctggaatgtgaagtcaatatgtatcggatgagcatcctggca tgtgagatgcatgaaacatggtatttttttactggacatcaaacatagga ctgatgagtatcaaataccatgtgtgagattcaagaattcattgggaaga acgaaaactggagacaaggaacatacttgacggctcc
Download
page-top