Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX163227
Length 794 bp
Fasta Format > whxt_13016_a03r
AGTCGACATTGTTTATGGTTAAGACTACGACGGTATCTAATCATCTTCGA TCCCCTAACTTTCGTTCTTGATCAATGAAAACATCCTTGTCAAATGCTTT CGCAGTAGTTTGTCTTTGATCAATCATAGGATTTCACCCCTAGCGATCAA ATACAAGTGACCCCAACTATCCCTTTTAATCATTACTATTAACCTTCAAA ACCAACAAAATCAAGGTTAATGTCCTATTCTATTATCCCATGCTGTAATA TTCAATTGTACATGTCATGTCTGCTTTAAACACTCTAATTTTTTCAAAGT AAACTATCTATTTCTACAAGAAAAGGTTTAACCCCAATCTTTAAAAAGAA ATAAAAAGAAAGGAAAAAATATATAGGAATGACTTTGCTTTAAAACAAAG ATCCCTTTATATAAATCCCTCAAGTCCAACTACGAGCTTTTTAACCGCAA CAACTTTAATATACACTCTTGGAGCTGGAGTTACCGCGGCTGCTGGCACC AGACTTGCCCTCCAATTGTTAGTCGTTAATGTTTTTAAATTGTTCTCATT CCAATCATTGTTCCCGTTGGGACCAATACTAGTATTTCTCGTCACTACCT CCCCGAATTGGGATTGGGTAATTTACGCGCCTGCTGCCTTCCTTGGAAGT AATGGCCGTCTCTCANNCCTTTTCTCCGGAATCAAACCCAAATTCTCCGT TACCCATCAAAACCATGGTAATCCACTAAATTACCATCGAAAGTTAATAG GTCNNNNNNNCGTTCCTATCATCTATAAATAATTAAATTTATGA
Download
page-top