Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX163217
Length 756 bp
Fasta Format > whxt_27016_a03f
GCTGGCATGGAGCCGGATCACAGAGGCCTGATGGCGATCGTGCGTGAAGA GCCGCCGCCGTCGGAGGAGCCGATGGACCTGCTGTCGAGCGCGTGGTGCA GCTCGGCGATCCAGGTTCTTCAGACGGGTCCGAAGGAGGAGGATCGCTCG CTGGCGCTGGTGGAGCACCCTGTCATGGGGCTTGATGATGATAGGAGAGA CCTGTCGCAGCTGCAGAGGAATGATCGTAGCTTGGTTGTTGACGACAGCG GCTTCGGTGGCGCGGCGCAGCCGCAATGGAAATACGAAGATCTGAAGTCA TGGATATGGCTGCAGAAGGCCATTCACCCGGAGCTGGACTACGACAANAA GAAGAAATGGCTCCCGCGCAAGATGGCGGCGCCATGGAGCGGCATCTCGC TCAAGAAGTGGGTCAAGGAGCGGAAGCAGAAGCGCAAGGAGGAGGCGCGG CTGCACAAGGCCGAGGTCCACGCCGCGGTGTCCGTCGCGGGCGTCGCGGC CGTGCTCGCCGCCATCGCCGCGGAGAACTCCGCGCCGGCGGCGCGCGGCT CGGCGTCGGCGTCGATGAGGGAGACGGCGGTGGCATCGGCGGCCGCGCTC GTGGCGGCGCAGTGCGCGAAGGTGGCCGAGGCCGCGGGCGCCACGCGGGA CCAGGTCGCCGCGGCCGTCAACGCCGCCGTGGCAGCCACGGACGCCAGCA ACGTGATCACGCTCACCGCCGCCGCCGCCACCTCACTGCGCGGCGCGGCG GCGCTG
Download
page-top