Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ495051
Length 463 bp
Fasta Format > whfl16f06
ggactgacattttttctccccaaccagcgaggaagaggaagaggaagcgg atcgagtcggcgagagcgagggcgaggacgatggcggcgctccggctagc ggtgaggagattttgcgaccgtgcgctcgggagatcagcgggcatttacg agctcaaggctgccaaggaattccccgacattgatcctgggcatctcaag gctgccaggaaattccccaaacttcgtgtcaaggatgttgatgctacggc tctgaatgtcttcaagattctcaggcagagtccagtcgatggtcatgtgc gcatgacactcaagaccttggctgagattcaggaagaagaatgaagatgc gctactaggaagcaatatcgtctcttgctctaatatgaactagctttgca gtattgtagtatttgaatctttcctatgttgtcgctctgtgtctcgatct tcaaaactgctgg
Download
page-top