Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493735
Length 414 bp
Fasta Format > whfl10h13
tcgaaatcattgccaatgaccagggcaaccgcaccacgccgtcgtacgtg gccttcaccgactccgagcgcctcatcggcgacgctgccaagaaccaggt ggcgatgaaccccatcaacaccgtcttcgatgccaagcgtctcattggcc ggagatttaccgattcaactgtccagagtgacattaagctgtggcccttc aaggttgttgctggacctggtgacaagcctatgattaatgtccagtacaa gggtgaggagaagcagtttgcagctgaggagatatcctctatggtggtga ggactttgataacaggatggtcaaccacttcgtccaggagttcaagagga agaacaagaaggacatcagtggcaacccgagagctcttcggaggctgagg acatcctgtgagag
Download
page-top