Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493716
Length 308 bp
Fasta Format > whfl10g08
accaccaatccaccatcaccacacatatcgatccgtacgccatggaagca ggcaagggtagtctccgggctgtgatcctcctcctgggcgcggtcctcgt cgtagggagcttggtgccgctggccgaggcagatccgacggccgccgcca ccggagctgcggacgccaagttctgctgcaaggacaagatagggagccac tgctacgccgcctgcactacgcagtacggccccaccccgttctgcgcgga gatgtgctgctgtgtgcagcttacgagcggcagatgcccgaggcaatgcc ccaccccg
Download
page-top