Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493712
Length 409 bp
Fasta Format > whfl10f19
cttcgcttctctggtgacgggttgcggcgccggcgacgaggcactgagca agatggcgagctcggcgctgagacgatctcttccacgacgcctgctcact tccgacccatcatccgccgcagcctccttgttccgccgctccttcctgtc cggagagggcgcgggggagagtgcggacgactttgagaaacgtctgtttg agtcagatgacaagtcattcttcgagaagctcgatggggtcgggagctcc tttggaagacacggcaccggctctggaatgggtgcttttggtcggcccga gtttggtcagcgtagtagtaatggtgggttcatggacggttttgattcct tgaacgatggcatgaacgagaagttggacgacgctgcccgcacctttcat atgacggag
Download
page-top