Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493711
Length 415 bp
Fasta Format > whfl10f13
agtccccccatccccgccgccgcctcctctcggttccttctccttcctcg gagcttcagccatgggtaaagagaagactcacatcaacatcgtggtcatt ggccatgtcgactctggcaagtcgaccaccactggccatctgatctacaa gcttggaggtattgacaagcgtgtgatcgagaggttcgagaaggaagccg ccgagatgaacaagaggtctttcaagtacgcctgggtgcttgacaagctg aaggccgagcgtgagaggggtatcaccattgatattgccctgtggaagtt cgagaccaccaagtactactgcaccgtcattgatgctcctggtcaccgtg acttcatcaagaacatgattactggtacctcccaggctgactgtgctgtg ctcatcattgactcc
Download
page-top