Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX149322
Length 806 bp
Fasta Format > whxs_15076_e19f
GTCCGTCGCAGCTCCAGATTTCCTTCCCCATGGCTCCGATCAAGATCGGC ATCAATGGTTTCGGCCGGATCGGCAGGCTTGTGGCCAGGGTTGCGCTCCA GAGCCCCGATGTCGAGCTCGTCGCCGTTAACGACCCCTTCATCACCACCG ACTACATGACCTACATGTTCAAGTATGACACTGTCCACGGACAGTGGAAG CACCATGAAGTTAAGGTGAAGGACTCCAAGACCCTTCTCTTCGGTGAGAA GGAGGTTGCGGTGTTTGGCTGCAGGAACCCAGAGGAGATCCCATGGGCTG CTGCTGGTGCTGAGTACGTTGTTGAGTCCACCGGTGTTTTCACTGACAAG GACAAGGCTGCAGCTCACATTAAGGGTGGTGCCAAGAAGGTCATCATTTC TGCTCCCAGCAAGGATGCTCCCATGTTTGTCTGTGGTGTCAATGAGAAGG AATACAAGTCTGACATCGACATTGTCTCCAACGCTAGCTGCACCACTAAC TGCCTTGCTCCTCTTGCTAAGGTTATCAATGACAGGTTTGGCATTGTTGA GGGTTTGATGACCACAGTTCATGCCATGACTGCAACCCAGAAGACTGTTG ATGGTCCTTCCAGCAAGGACTGGAGAGGTGGAAGGGCTGCCAGCTTCAAC ATCATTCCAAGCAGCACTGGTGCCGCAAAGGCTGTTGGCAAGGTGCTCCC AGAGCTTAACGGAAAGTTGACTGGAATGGCCTTCCGTGTTCCCACTGTTG ATGTTTCTGTTGTTGATCTGACTGTTAGACTTGCGAAGCCAGCAACCTAT GATCAG
Download
page-top