Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493693
Length 500 bp
Fasta Format > whfl10d20
gtcctccgctactcccctgcctcccccagagctcgttagggttttctcct ttttcgggggagaaatctcaagaggcggcaccatgctcgtgtaccaggac aagctttccggcgacgagcttctgtcggattcgttcccgtacagggagct ggagaacggcgtgctctgggaagtcgacggccattgggtcgttcaaggag cagttgatgtggacattggagccaatccctctgctgagggtggtggtgat ggatgagggtgtcgatgaccaggccgtgaaggtggttgacattgttgaca ccttccgtcttcaggagcaacctgcttttgacaagaagcagtttatctct cacatgaagcgctacatcaagaacctctctgccaagcttgaaggggatga cctanatgttttcaagaagaatgttgagtctgccacaaagtatcttctta gcaagctcaaggaccttcagttctttgttggcgagagcatgcatgatgat
Download
page-top