Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493690
Length 562 bp
Fasta Format > whfl10d15
cttcccgtgccaccacagccgccgcctcccccaccaacctgccccgaccc gctcccgacctccgaggcaagcagcgcctccgccatggcgttcgagaaga tcaaggtcaccaaccccatcgtcgagatggacggcgatgagatgaccaga gtattctggcagtctatcaaggacaagcttatcttcccatttttggactt ggacattaagtactttgacttgggagttctacaccgcgatgcaactgatg acaaggttacagtggaggctgcagaggctactctcaagtacaatgtggct attaaatgtgcaactattactccagatgaagatcgggttaaggagttcaa cctaaaacaaatgtggaggagcccaaatggcacaattaggaacattataa acggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagctt gttccaggatggactaagcccatctgcattggaagccatgctttcggtga tcagtacagagcaactgatgccgttctcaagggacctggcaaactcagac tagttttcgagg
Download
page-top