Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493687
Length 297 bp
Fasta Format > whfl10d10
gcagccaacaaacaaacatacctccactcattggagagccgctgctgctc gccggccctccctcggttccccatttctccacctcggagcagccgagccg acgcctccctcgccgccagcgtctccgtgaccgtaacccaccatgtcggg gatgaaggacgccaatgctgctgggcatgataatgttggaaattctgaac ctatggaccaaagtggagataatgccatgccatcggctcagcaacaggaa caagtaatcaagaagaagtttggaggactaattcctaaaaagccacc
Download
page-top