Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493684
Length 552 bp
Fasta Format > whfl10d05
aagagaattttctcctacctttcctttgcagttgcaaagcgtctcctctt ctctcctgctcctcctctcctaccatcgttgcctcccaccaaaccctaaa ccaagctccgaatccctcccgtctctacccccaccgagctcgcaagttct tgattggagcagccgagcccagctcagattccccgcggggtcccgggagt attcgaggtcttggcgggaagccaagaaatggcggagggggaggagacca aggtggagggaacgagagaggaagagagagcggatgcaggggcgggagcg gaggaggagggaggtaagaggtgaagttccggctcttcgacggctctgac atcggccccatccgctgcaacgccgctgctaccaccgtcgccgcactcaa ggaccgcgtcgttgccgattggcccaaagataaaacaattgtcccaaaga gtgctaatgatgtgaaactgataagtggaggcaaaattctagaaaatgac aagaatattgcacagtgcagagcaccttttggtgatcttcccagcactgt ta
Download
page-top