Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493680
Length 466 bp
Fasta Format > whfl10c20
agtgcgtctcagtcatccgtctggaacagcgatgactcgagaaccgtcct cttgcctttctgcccgcccacccgtctcctcgcctcgccgtctcgcccca cgccaccgccgcagccgctgcaaagatgccgttcaagaggttcgtcgaga tcgggcgggtggccctggtgaactacggcaaggactacggccgcctcgtc gtcatcgttgacgttgtcgaccagaaccgggcacttgtggatgctcccga tatggtcaggtgccagatgaacttcaagcgtctttcgctgaccgacatca agattgacatcaagcgtatccctaagaaggccactttgatcaaggccatg gaggaagctgatgtgaaaaccaaatgggagaacagctcatggggtaagaa gcttgttgtccagaagagaagagcatcgctgaatgactttgacaggttca aggtcatgttggctaa
Download
page-top