Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493679
Length 520 bp
Fasta Format > whfl10c19
ggggacggacattttttttctccccaaccagcgaggaagaggaagaggaa gcggatcgagtcggcgagagcgagggcgaggacgatggcggcgctccggc tagcggtgaggagattttgcgaccgtgcgctcgggagatcagcgggcatt tacgagctcaaggctgccaaggaattccccgacattgatcctgggcatct caaggctgccaggaaattccccaaacttcgtgtcaaggatgttgatgcta cggctctgaatgtcttcaagattctcagggagagtccagtcgatggtcat aaagatgtaacccttcgtgaagtgcgcatgacactcaagaccttggctga gattcaggaagaagaatgaagatgcgctactaggaagcaatatcgtctct tgctctaatatgaactagctttgcagtattgtagtatttgaatctttcct atgttgtcgctctgtgtctcgatcttcaaaactgctggacggatgtgatg ttttgctattttcttgcttc
Download
page-top