Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493672
Length 418 bp
Fasta Format > whfl10c02
cctcttgcctttctgcccgcccacccgtctcctcgcctcgccgtctcgcc ccacgccaccgccgcagccgctgcaaagatgccgttcaagaggtncgtcg agatcgggcgggtggccctggtgaactacggcaaggactacggccgcctc gtcgtcatcgttgacgttgtcgaccagaaccgggcacttgtggatgctcc cgatatggtcaggtgccagatgaacttcaagcgtctttcgctgaccgaca tcaagattgacatcaagcgtatccctaagaaggccactttgatcaaggcc atggaggaagctgatgtgaaaaccaaatgggagaacagctcatggggtaa gaagcttgttgtccagaagagaagagcatcgctgaatgactttgacaggt tcaaggtcatgttggcta
Download
page-top