Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493671
Length 559 bp
Fasta Format > whfl10b23
gccgtcctcctccatgccctagcgcgcacaccacggcacggcacaccgcg gcgcccgccccgaggtctttggtttgctgccctccgacacgctgtgacat agcctcttgatagcacaccaaatcaagagctcagcatggctgattccatg gcggattcgatggtggcaagcttctgggggccggttacatcaaccaccga gctgtgcgaggagaactatgcgcgctcgtcatacatcgcagagttctaca atactctctctaatgccccttgcattcttttggcgcttattgggctcgtg aatgctctccgccagcgtttcgagaagcgcttcagcgtcctgcacatatc caatatgatactttctattgggagtatcatcttccatgcaaccttgcaac atgtcttacagcagagtgacgagactccaatggtgtgggaaatcctccta tatctgtatgtcctttattcaccagactggcattacaggagcaccatgcc tactttccttgttctatacggtgctgcatttgctgtagttcacttcttcg tgcgattcc
Download
page-top