Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493670
Length 510 bp
Fasta Format > whfl10b21
gccgccgctccactcccccgcaaaaccctagcctttccccgcgccgcccc cgccgccgccccgtcgtccccaggtaaggaggagggcgagatggtgaagc acaacaacgtcatccccaacggccacttcaagaagcactggcagaactat gtcaagacgtggttcaaccagcccgcccgcaagcagaggcgccgcatcgc tcgccagaagaaggctgtgaagatcttcccccgtcctacctctggacctc ttcgccccattgtgcaatgccagacccgcaagtacaacatgaaggccagg gctggcaggggatttacccttgaggagcttaagtccgctggcatcccaaa gaagctcgctccgaccattggcatttctgtggaccaccgccgcaagaaca ggtcgcttgagggtatgcagtccaacatccagaggctcaagacctacaag gccaagcttgtcatcttcccaaggcgtgctcgcaaggtcaaggctggtga ctctactccg
Download
page-top