Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493664
Length 328 bp
Fasta Format > whfl10b12
gcgagaccaaaccaaagctgcggcggcgcgcgcataggaggcgaatcagc agcggaaccaagccgccgacgccaccatgggtatctcgcgtgactccatg cacaagcgccgggccaccggtgggaagcagaaggcttggaggaagaagcg aaagtatgagctcggccgccagccagccaacactaagctttcaagcaaca agacagtgaggagggtccgtgttcgcggaggtaacgtgaagtggagggct ctccgtcttgacactggtaacttctcgtggggtagtgaggctgtgacccg caagacccgtctcctggatgtggtttac
Download
page-top