Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493662
Length 127 bp
Fasta Format > whfl10b09
ggaaatcgttggaaagggcagctacggtgtcgtgtgctccgcaatagatg tccacaccggagagaaagtggcgataaaaaagatacatgatatctttgag cacatatctgatgctgcacggattctc
Download
page-top