Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493657
Length 467 bp
Fasta Format > whfl10b02
gcccggccccacctctcagtcctcaccctgccccctccattcgcccccct cccgccgaccagagaggcaggtcgccgccgacgagatctgagagctccgg aggccggatcccggccgctcaaaggcacgcggagatgaatctgtttcggc tcgccggggacatgacccacctcgtcagcgtggtggtgctgctcctcaag atccacaccatcaagtcgtgcgcaggcatatctctgaagacgcaggagct atacgcactagtttttgcagctcgctacctggatctgtttgtgcattttg tatctttgtataacaccgtcatgaagctggtcttcctggcgagctctttc tcaatagtttggtacatgaggaagcataagatcgtgcgtaggacctatga cagggagcacgacacctttcgccatcatttcatagtgctgccatgtttgg ttctggctctcctcatc
Download
page-top