Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493650
Length 567 bp
Fasta Format > whfl10a18
ggaaaagtggacagcagcactccgcggagcgccgggcgagatggggttca tcggcgaccaggtggagtcgatccgctcgatgcaggtccgccaggtgctc gcgcagatcatcagcctcggtatgattgttacgtcggcattgatcatatg gaaggggttgatggttgcgactgggagtgagtccccggtggtcgtggttc tttctggtagcatggagcctggattcaaaaggggtgatatcctgtttttt gcgcatgagcaaagaacccatccgtactggagaaatagttgtttttaatg ttgatggccgtgacattccaattgttcaccgtgtgattaaggttcatgaa cgccaggaaagtgctgaagttgacatcctcacgaaaggtgacaacaattt tggggatgaccgactgctgtacgcacaaggtcagctgtggcttcagcagc atcacattcatggggcgggctgtaggctatcttccatacctttgggtggg ttaccattgtgatgactganaagccgatcatcaagtaccttctgatcngc gcgctgggcctgctggt
Download
page-top